Nuestros Ranchos Site

Joseph,
Either day works for me, whatever day the majority of the other people are available to meet will be just fine. Just let me know the day and the time and I know the place already. Can't wait to meet up with you and with other members of Nuestros Ranchos.

Abrazos,
Alicia

________________________________
From: Joseph Puentes
To: announce@nuestrosranchos.org
Sent: Thursday, September 6, 2012 4:37 AM
Subject: [Nuestros Ranchos] My Trip To San José

I’ll be travelling to San José to visit my brother as he recovers from a
very serious illness. The critical part of his illness is past but he has a
long road ahead to full recovery.

If it works out I plan on having lunch with Alicia Carrillo in San José
sometime during the 2nd week of October maybe the 11th or 12th if she is
free on one of those dates. I will be taking her to lunch at a small Vegan
restaurant The Happy Bamboo (http://www.happybamboo.com/). Let me know if
anyone else would like to join us and I’ll try to firm up the date.

Note: this will not be a genealogy related event just lunch with a friend or
two.

Joseph

Joseph Puentes

Clean@h2opodcast.com

http://h2opodcast.com

Here is a transcription:
Joseph Feliz, español
En la Villa de los Lagos en onze dias del mes de Diziembre de setecientos y onze años Baptise y puse los oleos y chrisma a Joseph Feliz, español, hijo legitimo de Agustin Almag.. y de Franca [Francisca] ..mila Lopez, españoles y vecinos de esta villa. Fueron PP. [Padrinos] Manuel Lo(pez) y Maria Ximenez, españoles y vecinos de esta villa a quienes advertí de su parentesco y cognacion espiritual y lo firmé.
Ba. Miguel Gonzalez de los Barrios

The mother's middle name is probably Camila, as someone else suggested, though the small "ca" belongs to the abbreviation for Francisca.

This is a real challenge! All I could get was hijo lexitimo, and the first name of the first padrino mentioned: Manuel. Could the mother's name be Francisa (abbreviated?) Lopez and Manuel's last name also Lopez? Padrina Maria Ximenez?
Hope someone else will take a shot at this...

Regards,
Denise

The parents seem to be Agustin Almaguer and Francisca ---mila Lopez,
padrinos Manuel Lopez y Maria de Munoz. I'm sure others can provide a more
complete translation. Good Luck.
Raquel Ruiz

On Sun, Sep 2, 2012 at 9:42 AM, wrote:

> I found a baptism record for my 6th great grandfather, Joseph Feliz
> Almaguer born 11 Dec 1711 in Lagos de Moreno, Jalisco, Mexico, but can't
> make heads or tails of the writing. If anyone would be willing to take a
> stab at it and let me know what they think I would really appreciate it. It
> is the first record on the upper left hand side of the page. The link is
> below.
>
> https://familysearch.org/pal:/**MM9.3.1/TH-1-18573-17799-65?**
> cc=1874591&wc=12506714
>
> Thank you all in advance.
>
> I apologize for my previous post with out a topic line
>

Thanks Denise,
There are a lot of Romos in La Villita (near Jalpa) and I've been able to link most of them to Aguascalientes and Calvillo. Often the Romos married Velascos, Loera's, Lopez, Contreras, etc. I've also linked the Medinas of La Villita to Aguascalientes and Calvillo.

One family I'm looking to find is Jose Maria Romo and his wife Gertrudis Gonzalez, who were probably born around 1775. Jose Maria's father was Manuel Romo, who also had Roberta. I haven't established which Romo families were the first to move, so I appreciate you making the file available to all of us.

Arturo

Thanks Denise. I looked through your document on Romo in Sagrario and found a Romo connection to Guerra - not one I was looking for, but I also have a Romo/Guerra connection in that area that is clearly related - now I just have to do some sleuthing.

Nice job.

Jerry Stofleth

The wikipedia article on Marcos Escobedo has the following which seems to be relevent:

Marcos Marcelo Escobedo (1784–1833) was a military commander in the Mexican War of Independence. He later became Mayor of Colotlán, Jalisco.

Early life

Marcos Escobedo was born in 1784, son of José Joaquín Escobedo, presumably a descendant of the original Tlaxcaltec colonizers of the region.

Military career

In 1808, he held the title Second Lieutenant in the Spanish army and was governor of the Tlaxcala neighborhood. On November 1, 1808, he declared himself in favor of Mexico's independence from Spain, and along with a priest named Pablo José Calvillo and the indigenous garrisons of the region, put himself at the service of independence leader Miguel Hidalgo.

In January 1811, he and his troops participated in the Battle of the Bridge of Calderón. His troops suffered great losses in the battle and returned to Colotlán to face the troops of Francisco del Real, Juan Lozano, and Sebastián Gallegos, who had occupied the town's square in their absence. In the same month, they faced a battle in Las Canoas with the troops of royalist priest Álvarez known as "El Chicharronero". In April 1811, his troops faced the army of Colonel Pedro Celestino Negrete and were defeated in the Battle of Tierra Blanca. Marcos Escobedo went into hiding for several years after this defeat.

In 1817, he came out of hiding and once again joined the war for independence, fighting battles in the towns of San Andrés, Chalchihuites and Huejuquilla, gaining control of the region for the independence movement. He then joined forces with the armies of Tlaltenango and Jerez and launched a military campaign to take Bolaños and then Tepic.
Late life

On September 27, 1820, Marcos Escobedo organized great festivities in Colotlán to celebrate Mexican independence and the entrance of the independence movement's troops into Mexico City. In 1825, Marcos Escobedo was named Mayor of Colotlán. As mayor, he was charged with subjugating the indigenous groups in the region who opposed the distribution of communal lands. Marcos Escobedo died on August 7, 1833.r

In 1808, he held the title Second Lieutenant in the Spanish army and was governor of the Tlaxcala neighborhood. On November 1, 1808, he declared himself in favor of Mexico's independence from Spain, and along with a priest named Pablo José Calvillo and the indigenous garrisons of the region, put himself at the service of independence leader Miguel Hidalgo.

In January 1811, he and his troops participated in the Battle of the Bridge of Calderón. His troops suffered great losses in the battle and returned to Colotlán to face the troops of Francisco del Real, Juan Lozano, and Sebastián Gallegos, who had occupied the town's square in their absence. In the same month, they faced a battle in Las Canoas with the troops of royalist priest Álvarez known as "El Chicharronero". In April 1811, his troops faced the army of Colonel Pedro Celestino Negrete and were defeated in the Battle of Tierra Blanca. Marcos Escobedo went into hiding for several years after this defeat.

In 1817, he came out of hiding and once again joined the war for independence, fighting battles in the towns of San Andrés, Chalchihuites and Huejuquilla, gaining control of the region for the independence movement. He then joined forces with the armies of Tlaltenango and Jerez and launched a military campaign to take Bolaños and then Tepic.
Late life

On September 27, 1820, Marcos Escobedo organized great festivities in Colotlán to celebrate Mexican independence and the entrance of the independence movement's troops into Mexico City. In 1825, Marcos Escobedo was named Mayor of Colotlán. As mayor, he was charged with subjugating the indigenous groups in the region who opposed the distribution of communal lands. Marcos Escobedo died on August 7, 1833.

George Fulton
Pleasanton, CA

I do, on my mother's side; she was from New Mexico.

Emilie
Port Orchard, WA

> From: makas@nc.rr.com
> To: general@nuestrosranchos.org
> Date: Sun, 15 Jul 2012 07:09:17 -0400
> Subject: [Nuestros Ranchos] Montoya, Valdez(s), Quintana, Vigil, Martin(es)ez), Duran in New Mexico
>
> Does anyone in the group have Montoya, Valdez(s), Quintana, Vigil,
> Martin(es)ez), Duran.
>
> Who migrated to New Mexico? If so I have a contact person for you.
>
>
>
> Thanks,
>
>
>
> Joseph
>
>
>
>
>
> Joseph Puentes
>
> Clean@h2opodcast.com
>
> http://h2opodcast.com
>
>
>
>
>

It is from the 1600's and difficult to read, but here is what I got:

It states the three times the plans to marry were announced,and then name Nicolas de Armas.
After Nicolas de Armas, looks like esp (espanol) and then something I have never seen before: mocosoltero. So I googled it and moco soltero pops up in other texts and is an old fashioned way of saying handsome single young man.

Likewise it looks like moca doncella (abr. don_a)is whats written after Juana's name, moca doncella also shows up on a google search and means something like beatiful and young (virgin)girl. Doncella I have seen before, and soltero, but not moca/moco. Learned something new!And it looks like Dona (abbreviated) in front of Juanas name.

Nicolas son of:
Miguel de Armas, deceased and Andrea (?) de Avila, desceased..."dicho ciudad" (of said town/city) The word after the abbreviation of difunto and before "dicho" I cannot read.

Dona Juana is either dau or ward of (?) Leonor de Lesalde espanola and Antonio de Robalcaba (caste or nationality which I dont recognize). Possibly deceased (difuntos). There is text here which I cannot decipher, but surely someone used to reading records from this time period would be able to...

Padrinos: Pedro de Ulloa and Dona Josepha de Sepulveda his wife. I think its odd that there's no Don in front of Pedro...

Hope this helps at least a little bit! And I hope someone out there can add more...

Regards
Denise Fastrup

Can't say they are exclusively there but some of Maria de La Torre records
for that time period can be found in the Colotlan archives - for example:

https://familysearch.org/pal:/MM9.3.1/TH-1-18450-31025-92?cc=1874591&wc…
3895

joseph

=========================

Joseph Puentes
Clean@h2opodcast.com
http://h2opodcast.com

> -----Original Message-----
> From: research-bounces@lists.nuestrosranchos.org [mailto:research-
> bounces@lists.nuestrosranchos.org] On Behalf Of rvr_jr@msn.com
> Sent: Sunday, September 02, 2012 6:29 AM
> To: research@lists.nuestrosranchos.org
> Subject: [Nuestros Ranchos] Baptism records for Maria de la Torre,
Zacatecas?
>
> What church records should I be searching to find a baptism record from
1827?
>
> T.I.A.,
> Roy

What town or city in Zacatecas? or is it the city of Zacatecas proper?

Alicia
San Jose, Ca

________________________________
From: "rvr_jr@msn.com"
To: research@lists.nuestrosranchos.org
Sent: Sunday, September 2, 2012 3:28 AM
Subject: [Nuestros Ranchos] Baptism records for Maria de la Torre, Zacatecas?

What church records should I be searching to find a baptism record from 1827?

T.I.A.,
Roy

Hello Ms. Gomez, badoo is a dating focused social networking site and as i am not single, i would prefer to be contacted for genealogy reseach through this forum or google mail, as others have done, not by a link which may just be spam. Like everyone else, I am wary of computer viri and unwanted cookies. If you have a question or comment relevant to my areas of interest as described in my userprofile and previous posts, you are very welcome to contact me.
Regards, Denise Fastrup

Thanks to a little girl's pinkie bone.  Fascinating!

--- On Fri, 8/31/12, Alicia Carrillo wrote:

From: Alicia Carrillo
Subject: [Nuestros Ranchos] DNA of The Denisovens of Siberia
To: "general@nuestrosranchos.org"
Date: Friday, August 31, 2012, 11:11 PM

Today while driving home from work, I was listening to NPR specifically to the California Report about a just published study in a science journal about the DNA findings of the Denisovens. To those of you who might be more experienced in DNA, this might be old news, but for me, this is new news. I came home straight to my computer to search for articles about our ancient ancestors, the Denisovens.

Alicia,
Northern California

Here's a brief intro into this article, I hope you find it as fascinating as I did.

THE Denisovans, mysterious cousins of the
Neanderthals, occupied a vast realm stretching from the chill expanse of Siberia to the steamy tropical forests of Indonesia - suggesting the
third human of the Pleistocene displayed a level of adaptability
previously thought to be unique to modern humans.
Our first tantalising glimpse of the Denisovans came last year with DNA analysis of a bone and tooth found in a Siberian cave. The DNA was distinct
enough from Neanderthals' to suggest tens of thousands of years of
independent evolution.
Before they disappeared, the Denisovans found time to interbreed with Homo sapiens. As a result, 5 per cent of the Denisovan genome lives on - not in the
inhabitants of Siberia but in Papua New Guineans, living thousands of
kilometres to the south-east (Nature, DOI: 10.1038/nature09710).

http://www.newscientist.com/article/mg21128323.200-the-vast-asian-realm…

>> Anyway my too long of point is I don't think it matters where you go you just need to be aware that what comes back may look surprising so you may need to do some additional research to make sense of it.

Applause!!!

Very well said. Our story was not inspired by DNA results, but rather the appearance of a Mongolian birthmark on our first-born son. Both my husband and I were doing some head scratching. Our families were all speculating about the Mongolian immigration, indigenous lineage, etc. Research has now shown us that my husband's great grandfather immigrated to Mexico from China. Now I look forward to some fun when we finally get our DNA testing done.

Emilie,

It is interesting to see you also got Haplogroup C. I notice not many members here have that MtDNA Haplogroup.

I also have Haplogroup C, and I noticed many in the same Haplogroup do have their ancestral origins in New Mexico.

Hello Emilie,

The colonization of the Americas happened about close to 15,000-18,000
years ago and there were 15 founding mtDNA lineages according to the two
following articles.

http://www.sciencedaily.com/releases/2011/10/111020145054.htm

http://www.sciencedaily.com/releases/2010/06/100628170926.htm

Native American Y-DNA is also an interesting subject. Hopefully more
studies will be realized with those groups in the coming years. In the
following page they compare Sioux, Chippewa, Pima, Tarahumara, Nahua, and
Otomí, and Qechua speakers.

http://dienekes.blogspot.com/2012/05/y-chromosome-diversity-in-native.h…

Your mtDNA haplogroup started 40,000 years ago and they determine that by a
calculation of mutation rates. Your ancestor that had that first mutation
lived in Asia and her descendants didn't cross the Bering Strait until
15,000-18,000 years ago. A mutation is the sudden change in genes or
chromosomes between an organism or being and an offspring. This is what
caused evolution. The beings with the mutations that were better suited to
changes in the environment were the ones that survived. Mutations can be
seen in the DNA because of sequences that change. These sequences are
represented by the letters A, T, C, and G which stand for four chemical
bases: adenine (A), guanine (G), cytosine (C), and thymine (T). The DNA
strands with a string of letters like
this:ATATTTGAAAGCTGTGTCTGTAAACTGATGGCTAACAAAACTAG Certain areas of the
DNA have
certain sequences and when there is a difference between one person and
another that is the mutation they are speaking of.

I don't think mtDNA changes as often as Y-DNA which is why it is harder to
find matches with people with the same surname apart from the fact that the
population size has to be fairly large and there have to be enough people
willing to test. Unfortunately there are too many people unwilling to test
in all segments which slows the discovery process. We need more people
willing to test and share the data. I think their inability to understand
what can be derived from DNA or what it means keeps them from doing this.
It is very sad really.

Saludos
Armando

On Mon, Jul 2, 2012 at 9:26 PM, Emilie Garcia wrote:

>
> I just got my MtDNA results from FamilyTreeDNA.
>
> I am haplogroup C, which supposedly "is found in eastern Eurasia and
> throughout the Americas. This haplogroup was present in the populations
> that initially colonized the pre-Columbian Americas, and dates to at least
> 40,000 years ago. Future work will resolve the issue of how many distinct
> colonization events there were in the original peopling of the Americas,
> and the role of individuals bearing haplogroup C." (Description used
> without written permission).
>
> Eastern Eurasia. No wonder people from there mistake me for Filipino or
> Thai. This happens frequently. I do have an Asian cast to my eyes.
>
> They also sent a map showing the migration of haplogroup C from eastern
> Africa across Asia, over the Bering Straight, down Alaska and Canada, and
> then to North, Central and South America.
>
> Maybe when I go to Arizona, and they ask for my papers, I can show them
> this to prove I didn't hop the fence yesterday, and ask them to show me
> theirs. Forty thousand years! I guess I am as "American" as anybody can
> get. I knew I was Native American--all I have to do is look in the
> mirror---and my mother's people-- the Piro-Manso-Tewa- have been in some
> pueblos in New Mexico that have been continually occupied for over a
> thousand years, but they have really been there 40,000 years? How do they
> figure that? Wow!
>
> They also sent a graph of "HVR1 Differences from rCRS" (mutations?):
> 1609C, 16176T, 1628T, 1629C, 16325C, 16327T, and 16519C. I also clicked
> on "Show All Positions" and I got a very long string of the same thing, but
> the letters included were A, T, C, and G. Are those haplogroups? What are
> they?
>
> I am not a total dummy, but this DNA stuff has me in a tizzy. What are
> mutations? What are the differences? Should I care? I tried looking at
> their tutorials, but I ended up feeling like an imbecile, not understanding
> a thing. Their website also is very difficult to maneuver. I couldn't
> find my results until I clicked on dozens of titles.
>
> They also sent a list of "matches". Some have Anglo surnames, but their
> "most distant known female ancestor" are all from New Mexico. The surnames
> of these ancestors are not in my lines, but they are all common to New
> Mexico. I guess that just means that no one with my particular surnames
> submitted their MtDNA.
>
> Thank you in advance for any help in understanding this,
>
> Emilie
> Port Orchard, WA

Primero que nada bienvenido al foro,,, al parecer somos parientes te mando datos de ancestros de Francisco y de Tomasa Garcia, yo desciendo por dos lineas de este francisco ya que caso dos veses primero con Tomasita Garcia y despues con Dolores Gomez de Mendoza,,, del Matrimonio de francisco de Mendoza y Tomasita deciendo de Maria Manuela Gtz casada con Nicolas Glz de Ruvalcaba

espero le puedas entender ,,cualquier duda estoy a tus ordenes
Ancestros de Francisco Gtz

1ra Generación

1. Francisco Gutierrez De Hermosillo nació el 3 Abr. 1687 en Ocotlan, Jalisco, Mexico y murió en una fecha desconocida.

Padre: 2. Lazaro Gutierrez Hermosillo nació en 1654 y murió en una fecha desconocida.

Madre: 3. Ines de la Mora nació el 10 Feb. 1669 en Ocotlán, Jalisco, México y murió en una fecha desconocida.

2da Generación (Padres)

2. Lazaro Gutierrez Hermosillo nació en 1654 y murió en una fecha desconocida. El se casó con Ines de la Mora el 7 Feb. 1684 en Ocotlan, Jalisco, Mexico.

Padre: 4. Francisco Gutierrez Rubio nació en 1610 en Jalostotitlan, Jalisco y murió el 12 Ene. 1692.

Madre: 5. Juana Lomelin nació en 1610 y murió el 20 Oct. 1692 en Tepatitlan jalisco.

3. Ines de la Mora nació el 10 Feb. 1669 en Ocotlán, Jalisco, México y murió en una fecha desconocida.

Padre: 6. Fernando de la Mora nació en 1610 y murió en una fecha desconocida.

Madre: 7. Maria Zamora murió en una fecha desconocida.

3ra Generación (Abuelos)

4. Francisco Gutierrez Rubio nació en 1610 en Jalostotitlan, Jalisco y murió el 12 Ene. 1692. El se casó con Juana Lomelin en 1651 en Nochistlan, Zacatecas, Mexico.

Padre: 8. Miguel Gutierrez Rubio nació en 1584 y murió en una fecha desconocida.

Madre: 9. Leonor Hermosillo nació en 1588 y murió el 8 Dic. 1682 en Jalostotitlan, Jalisco, Mexico.

5. Juana Lomelin nació en 1610 y murió el 20 Oct. 1692 en Tepatitlan jalisco.

Otros eventos en la vida de Juana Lomelin
Sepultura Jalostotitlan. Jalisco

Padre: 10. Carlos Lomelin nació en 1584 en Genova, Genova, Italia y murió en una fecha desconocida.

Madre: 11. Maria Benavides nació en 1590 en Nochistlan, Zacatecas, Mexico y murió el 9 Dic. 1669 en Jalostotitlán, Jalisco, México.

6. Fernando de la Mora nació en 1610 y murió en una fecha desconocida. El se casó con Maria Zamora.

7. Maria Zamora murió en una fecha desconocida.

4ta Generación (Bisabuelos)

8. Miguel Gutierrez Rubio nació en 1584 y murió en una fecha desconocida. El se casó con Leonor Hermosillo en 1609.

Padre: 12. Francisco Gutierrez Rubio nació en Jalostotitlan, Jalisco y murió en Jalostotitlan, Jalisco.

Madre: 13. Ana Gonzalez Florida murió el 7 May 1672 en Jalostotitlán, Jalisco, México.

9. Leonor Hermosillo nació en 1588 y murió el 8 Dic. 1682 en Jalostotitlan, Jalisco, Mexico.

Padre: 14. Juan Gonzalez de hermosillo nació en 1571 y murió en 1627.

Madre: 15. Maria Muñoz murió en una fecha desconocida.

10. Carlos Lomelin nació en 1584 en Genova, Genova, Italia y murió en una fecha desconocida. El se casó con Maria Benavides Alrededor de 1609 en Nochistlan, Zacatecas, Mexico.

11. Maria Benavides nació en 1590 en Nochistlan, Zacatecas, Mexico y murió el 9 Dic. 1669 en Jalostotitlán, Jalisco, México.

5ta Generación (Tatarabuelos)

12. Francisco Gutierrez Rubio nació en Jalostotitlan, Jalisco y murió en Jalostotitlan, Jalisco. El se casó con Ana Gonzalez Florida.

Padre: 16. Diego Gonzalez Rubio nació en Primeros Pobladores de Jalostotitlan y murió en una fecha desconocida.

Madre: 17. Maria Rubio murió en una fecha desconocida.

13. Ana Gonzalez Florida murió el 7 May 1672 en Jalostotitlán, Jalisco, México.

14. Juan Gonzalez de hermosillo nació en 1571 y murió en 1627. El se casó con Maria Muñoz.

Padre: 18. Juan Gonzalez de Hermosillo murió en una fecha desconocida.

Madre: 19. Ana Rodriguez de Magdaleno murió en una fecha desconocida.

15. Maria Muñoz murió en una fecha desconocida.

6ta Generación (Tatara-Tatarabuelos)

16. Diego Gonzalez Rubio nació en Primeros Pobladores de Jalostotitlan y murió en una fecha desconocida. El se casó con Maria Rubio.

17. Maria Rubio murió en una fecha desconocida.

18. Juan Gonzalez de Hermosillo murió en una fecha desconocida. El se casó con Ana Rodriguez de Magdaleno.

19. Ana Rodriguez de Magdaleno murió en una fecha desconocida.

y De Tomasita Garcia de Hermosillo seria lo siguiente

1. Tomasa Garcia De Hermosillo nació en 1693 en Jalostotitlan, Jalisco, Mexico y murió el 19 Nov. 1730 en Lagos De Moreno, Jalisco, Mexico.

Padre: 2. Agustin II Garcia Ramirez nació en 1657 en San Juan de los Lagos y murió el 24 Jun. 1718 en san Juan de los Lagos.

Madre: 3. Josefa Marquez de los olivos nació en 1661 en san Juan de los Lagos y murió en san Juan de los Lagos.

2da Generación (Padres)

2. Agustin II Garcia Ramirez nació en 1657 en San Juan de los Lagos y murió el 24 Jun. 1718 en san Juan de los Lagos. El se casó con Josefa Marquez de los olivos.

Padre: 4. Agustin Garcia de Hermosillo nació en 1624 en Jalostotitlan, Jalisco, Mexico y murió en una fecha desconocida.

Madre: 5. Maria Muñoz de la Barba nació en 1635 en Jalostotitlan, Jalisco, Mexico y murió el 22 Dic. 1671 en Estancia de Agustin Garcia.

3. Josefa Marquez de los olivos nació en 1661 en san Juan de los Lagos y murió en san Juan de los Lagos.

Padre: 6. Diego Marquez de los olivos nació en 1620 en Puebla y murió el 18 Mar. 1672.

Madre: 7. Maria de la Cruz Martin del campo nació el 3 Jun. 1640 y murió en una fecha desconocida.

3ra Generación (Abuelos)

4. Agustin Garcia de Hermosillo nació en 1624 en Jalostotitlan, Jalisco, Mexico y murió en una fecha desconocida. El se casó con Maria Muñoz de la Barba en 1651.

Padre: 8. Diego Alfonso Ramirez murió en una fecha desconocida.

Madre: 9. Paula Torres nació en 1602 en Aguascalientes, Aguascalientes, Mexico y murió en una fecha desconocida.

5. Maria Muñoz de la Barba nació en 1635 en Jalostotitlan, Jalisco, Mexico y murió el 22 Dic. 1671 en Estancia de Agustin Garcia.

Padre: 10. Francisco Muñoz de la Barba murió el 27 Jun. 1667 en Jalostotitlán, Jalisco, México.

Madre: 11. Catalina Gutierrez Rubio murió en una fecha desconocida.

6. Diego Marquez de los olivos nació en 1620 en Puebla y murió el 18 Mar. 1672. El se casó con Maria de la Cruz Martin del campo en 1658 en San Juan De Los Lagos, Jalisco, Mexico.

Padre: 12. Jose Marquez de los olivos nació en Puebla y murió en una fecha desconocida.

Madre: 13. Maria Ornelas murió en una fecha desconocida.

7. Maria de la Cruz Martin del campo nació el 3 Jun. 1640 y murió en una fecha desconocida.

Padre: 14. Lazaro Martin del campo nació el 2 Abr. 1608 en Revilla de Campos, Palencia, España y murió el 22 Mar. 1674 en San Juan De Los Lagos.

Madre: 15. Maria Gertrudis Lopez de la cruz nació en 1609 y murió 22 de mayo de 1670 en San Juan de los Lagos, Jalisco..

4ta Generación (Bisabuelos)

8. Diego Alfonso Ramirez murió en una fecha desconocida. El se casó con Paula Torres.

Padre: 16. Juan Gonzalez de hermosillo nació en 1571 y murió en 1627.

Madre: 17. Maria Muñoz murió en una fecha desconocida.

9. Paula Torres nació en 1602 en Aguascalientes, Aguascalientes, Mexico y murió en una fecha desconocida.

Padre: 18. Nicolas Ramirez murió en una fecha desconocida.

Madre: 19. Polonia De Torres nació en 1569 y murió en una fecha desconocida.

10. Francisco Muñoz de la Barba murió el 27 Jun. 1667 en Jalostotitlán, Jalisco, México. El se casó con Catalina Gutierrez Rubio, es hija de Francisco Gutierrez Rubio y Ana Gonzalez Florida, en 1619 en Jalostotitlan, Jalisco, Mexico.

11. Catalina Gutierrez Rubio murió en una fecha desconocida.

Padre: 20. Francisco Gutierrez Rubio nació en Jalostotitlan, Jalisco y murió en Jalostotitlan, Jalisco.

Madre: 21. Ana Gonzalez Florida murió el 7 May 1672 en Jalostotitlán, Jalisco, México.

12. Jose Marquez de los olivos nació en Puebla y murió en una fecha desconocida. El se casó con Maria Ornelas, es hija de Alvaro Ornelas y Isabel De Mendoza, el 28 Abr. 1614 en Lagos De Moreno, Jalisco, Mexico.

13. Maria Ornelas murió en una fecha desconocida.

Padre: 22. Alvaro Ornelas murió en una fecha desconocida.

Madre: 23. Isabel De Mendoza nació en 1568 y murió en una fecha desconocida.

14. Lazaro Martin del campo nació el 2 Abr. 1608 en Revilla de Campos, Palencia, España y murió el 22 Mar. 1674 en San Juan De Los Lagos. El se casó con Maria Gertrudis Lopez de la cruz en 1627 en Guadalajara Jalisco.

Padre: 24. Bartolome Martin del campo y Antolin murió en una fecha desconocida.

Madre: 25. Juana Garcia murió en una fecha desconocida.

15. Maria Gertrudis Lopez de la cruz nació en 1609 y murió 22 de mayo de 1670 en San Juan de los Lagos, Jalisco..

Padre: 26. Gabriel Lopez de la cruz murió en una fecha desconocida.

Madre: 27. Ana Maria De Paz murió en una fecha desconocida.

5ta Generación (Tatarabuelos)

16. Juan Gonzalez de hermosillo nació en 1571 y murió en 1627. El se casó con Maria Muñoz.

Padre: 28. Juan Gonzalez de Hermosillo murió en una fecha desconocida.

Madre: 29. Ana Rodriguez de Magdaleno murió en una fecha desconocida.

17. Maria Muñoz murió en una fecha desconocida.

18. Nicolas Ramirez murió en una fecha desconocida. El se casó con Polonia De Torres.

Padre: 30. Francisco Tavera de la Vega murió en una fecha desconocida.

19. Polonia De Torres nació en 1569 y murió en una fecha desconocida.

20. Francisco Gutierrez Rubio nació en Jalostotitlan, Jalisco y murió en Jalostotitlan, Jalisco. El se casó con Ana Gonzalez Florida.

Padre: 31. Diego Gonzalez Rubio nació en Primeros Pobladores de Jalostotitlan y murió en una fecha desconocida.

Madre: 32. Maria Rubio murió en una fecha desconocida.

21. Ana Gonzalez Florida murió el 7 May 1672 en Jalostotitlán, Jalisco, México.

22. Alvaro Ornelas murió en una fecha desconocida. El se casó con Isabel De Mendoza el 29 Oct. 1586 en Santa Maria De Los Lagos, Lagos De Moreno, Jalisco, Mexico.

23. Isabel De Mendoza nació en 1568 y murió en una fecha desconocida.

Padre: 33. Toribio Hernandez de Arellano nació en 1540 y murió en una fecha desconocida.

Madre: 34. Isabel De Mendoza nació en 1550 y murió en una fecha desconocida.

24. Bartolome Martin del campo y Antolin murió en una fecha desconocida. El se casó con Juana Garcia.

25. Juana Garcia murió en una fecha desconocida.

26. Gabriel Lopez de la cruz murió en una fecha desconocida. El se casó con Ana Maria De Paz el 3 Feb. 1608 en Sagrario Metropolitano, Guadalajara, Jalisco, Mexico.

27. Ana Maria De Paz murió en una fecha desconocida.

6ta Generación (Tatara-Tatarabuelos)

28. Juan Gonzalez de Hermosillo murió en una fecha desconocida. El se casó con Ana Rodriguez de Magdaleno.

29. Ana Rodriguez de Magdaleno murió en una fecha desconocida.

30. Francisco Tavera de la Vega murió en una fecha desconocida. El se casó con (Desconocido).

31. Diego Gonzalez Rubio nació en Primeros Pobladores de Jalostotitlan y murió en una fecha desconocida. El se casó con Maria Rubio.

32. Maria Rubio murió en una fecha desconocida.

33. Toribio Hernandez de Arellano nació en 1540 y murió en una fecha desconocida. El se casó con Isabel De Mendoza en 1565.

34. Isabel De Mendoza nació en 1550 y murió en una fecha desconocida.

Me da gusto que has ingresado al foro. Bienvenido Salvador.
Cuenta conmigo si tienes preguntas sobre genealogia u
otra cosa con gusto te ayudo.

Daniel Méndez Camino
mendezdelcamino@live.com

You have posted links to the indexed data instead of the images which is more important since they contain info not found in the index.

Have you gone through the images of Información Matrimonial? If not, then you need to and you should index them and share them.

Have you done a Y-DNA 37 marker test with FamilyTreeDNA.com Mexico project? If not you should also do that at http://www.familytreedna.com/group-join.aspx?Group=Mexico-DNA

Armando

Gloria Casillas
trate de ayudarte pero sin exito, leí el acta y ella se llama mariana, originaria de tizapan el alto, busque ahí, pero las actas comienzan a partir de 1817, intenta con los hijos de la pareja, en ocasiones los familiares son los padrinos y por medio de ellos encuentres el lugar de nacimiento o en los censos, de estos últimos no se mucho y no he encontrado quien me ayude con esto. También busque la descendencia de Marcos Timoteo Garza y María Josefa Pantoja y no encontré nada, tal vez aun no están indexados. Suerte espero los encuentres.